Selection of AP-PCR markers and conditions for Hypericum maculatum crantz
Author | Affiliation | |
---|---|---|
Barcaccia, Gianni | ||
Date |
---|
2015 |
Species belonging to Hypericum L. genus are rich in flavonoids and essential oils and have been widely used in pharmacology. DNA markers as a standard approach to relate these molecular systems nowadays are widely used. Hypericum perforatum and Hypericum maculatum are two widely spread species in Lithuania. Throughout the world various aspects of biology of H. perforatum including molecular genetics has got much bigger attention in comparison to H. maculatum. Present study is aimed at development and specialization of arbitrarily chosen primers and conditions of the polymerase chain reaction (PCR) for H. maculatum. Five different sequences containing universal primer M13 (GACGGCCAGT) were chosen for investigation: APPCR_KA2 (GACGGCCAGTCGTGTCCGAG); APPCR_KB2 (GACGGCCAGTCGTATACTCC); APPCR_KX2 (GACGGCCAGTTTGTACATGAC); APPCR_KM2 (ACGGCCAGTT ACGCACAAC); APPCR_KR2 (TTGTAAAACGACGGCCAGTRTGTATACATAYGTAAC), hereafter used in abbreviated form – KA2, KB2, KX2, KM2, KR2. Polymerase Chain Reaction mixture consisted of 3 μl genomic DNA, 0.5 μl of each primer (100 μM/μL), 0.2 μl Taq polimerase (5 U/μl), 2 μl 10xNH4 Taq buffer, 0.8 μl dNTP (25nM), 12.2 μl H2O. Requirements of MgCl2 were not equal and ranged between 0.8-1.2 μl (50 nM). Only KR2_KA2 primer combination required addition of 5 μl (4 μl +1 μl) of CES (2.7 M betaine, 6.7 mM DTT, 6.7% DMSO, 55 mg/ml BSA) in order to avoid potential inhibitory affect on PCR caused by secondary metabolites. Separated subsequent addition of universal labeled primer M13 provided better PCR results in comparison to simultaneous application of all markers. Universal primer M13 (GACGGCCAGT) end was conjugated with fluorescent tags 6FAM (blue), TAMRA (black) and HEX (green). Amplification cycles were divided into three stages differently to two stages applied by Welsh, McClelland (1990). [...].