Please use this identifier to cite or link to this item:https://hdl.handle.net/20.500.12259/56691
Type of publication: Tezės kituose recenzuojamuose leidiniuose / Theses in other peer-reviewed publications (T1e)
Field of Science: Biologija / Biology (N010)
Author(s): Barcaccia, Gianni;Galla, Giulio;Zybartaitė, Lina;Railienė, Indrė;Paulauskas, Algimantas;Kupčinskienė, Eugenija
Title: Selection of AP-PCR markers and conditions for Hypericum maculatum crantz
Is part of: The vital nature sign [elektroninis išteklius] : 9th international scientific conference : abstract book. Kaunas : Vytautas Magnus university, 2015, [no. 9]
Extent: p. 40-40
Date: 2015
Keywords: Medicinal plants;St. John's-wort;Population;Genetic diversity
Abstract: Species belonging to Hypericum L. genus are rich in flavonoids and essential oils and have been widely used in pharmacology. DNA markers as a standard approach to relate these molecular systems nowadays are widely used. Hypericum perforatum and Hypericum maculatum are two widely spread species in Lithuania. Throughout the world various aspects of biology of H. perforatum including molecular genetics has got much bigger attention in comparison to H. maculatum. Present study is aimed at development and specialization of arbitrarily chosen primers and conditions of the polymerase chain reaction (PCR) for H. maculatum. Five different sequences containing universal primer M13 (GACGGCCAGT) were chosen for investigation: APPCR_KA2 (GACGGCCAGTCGTGTCCGAG); APPCR_KB2 (GACGGCCAGTCGTATACTCC); APPCR_KX2 (GACGGCCAGTTTGTACATGAC); APPCR_KM2 (ACGGCCAGTT ACGCACAAC); APPCR_KR2 (TTGTAAAACGACGGCCAGTRTGTATACATAYGTAAC), hereafter used in abbreviated form – KA2, KB2, KX2, KM2, KR2. Polymerase Chain Reaction mixture consisted of 3 μl genomic DNA, 0.5 μl of each primer (100 μM/μL), 0.2 μl Taq polimerase (5 U/μl), 2 μl 10xNH4 Taq buffer, 0.8 μl dNTP (25nM), 12.2 μl H2O. Requirements of MgCl2 were not equal and ranged between 0.8-1.2 μl (50 nM). Only KR2_KA2 primer combination required addition of 5 μl (4 μl +1 μl) of CES (2.7 M betaine, 6.7 mM DTT, 6.7% DMSO, 55 mg/ml BSA) in order to avoid potential inhibitory affect on PCR caused by secondary metabolites. Separated subsequent addition of universal labeled primer M13 provided better PCR results in comparison to simultaneous application of all markers. Universal primer M13 (GACGGCCAGT) end was conjugated with fluorescent tags 6FAM (blue), TAMRA (black) and HEX (green). Amplification cycles were divided into three stages differently to two stages applied by Welsh, McClelland (1990). [...]
Internet: https://hdl.handle.net/20.500.12259/56691
Affiliation(s): Biologijos katedra
Gamtos mokslų fakultetas
Vytauto Didžiojo universitetas
Appears in Collections:Universiteto mokslo publikacijos / University Research Publications

Files in This Item:
marc.xml9.8 kBXMLView/Open

MARC21 XML metadata

Show full item record
Export via OAI-PMH Interface in XML Formats
Export to Other Non-XML Formats

Page view(s)

140
checked on Dec 9, 2019

Download(s)

10
checked on Dec 9, 2019

Google ScholarTM

Check


Items in DSpace are protected by copyright, with all rights reserved, unless otherwise indicated.